![]() ![]() ![]() And one of the best gifts guaranteed to get a laugh (or at least an entertained eyeroll, which is the greatest compliment for dad jokes) is to get someone the punniest gift you can! Here are a few perfect puns and dad jokes to get for your loved ones this year (be sure to read the titles for maximum punderstanding). Anyone can appreciate a good pun, or the CLASSIC “nice to meet you, very! I’m dad!” after someone says “I’m hungry”. Mosh Pit joke in Pick-Up Lines to make you laugh out loud :) See how long you can go with a straight face : after seeing the 90s Booty Call. Although he didn’t invent the mosh pit as we. As reported on by The Daily Mail, her findings tell a deeper story of the subculture and specifically its mosh pits. Im going to use this ladder to climb up the tree and shake the branch the gorilla is on to knock him to the ground. Researcher Linday Bishop from the University College in London spent 10 years studying heavy metal and the people who attend metal shows, including crowds at 3Teeth, Fear Factory, Mortiis and Pig concerts. ![]() The animal control employee tells the man, 'Im here to get the gorilla out of your tree. 1: Hold Your Own When Things Gets Shaky, Balance is Everything The more intense the pit, the more pushing, shoving, crowdkilling, and crowd surfing there will be, and the easier it can be to get knocked over. The joke is the 1st site that you gave for example. Joe King Carrasco appears crowdsurfing in 1981 music video In his video for 'Party Weekend, Carrasco can be seen surfing on a sea of hands. He calls animal control and about an hour later a man shows up with a ladder, a pit bull, and a shotgun. Dad jokes – much like dad hats – aren’t just for dads. Mosh Pit : Cest tout simplement larne o se jettent les fauves lors des concerts de metal. ![]() Her husband comes in, sees her all hot and sweaty, and the sheets all messed up. The woman says, 'It's my husband You'd better hide.' She throws his clothes under the bed and he hides behind the curtains. These stops occur in an area called the pits, most commonly accessed via a pit lane which runs parallel to the start/finish straightaway. only screen and (max-width:37.31em)/*!sc*/ A man and a woman are getting it on in bed when they hear the front door open. 1 comment u/nwmimms report What’s the difference between a hot dog and a pit bull A pit bull bites the hand that feeds it, while a hot dog feeds the hand that bites it. ![]()
0 Comments
![]() ![]() ![]() Though Olly supplements have not been included in any research studies, most of the brand’s products are formulated using clinically studied ingredients. Some also note that the packaging can be difficult to open. On the other hand, less favorable reviews report an unpleasant flavor, smell, and aftertaste. A few also mention experiencing beneficial health effects with consistent use. ![]() Positive reviews state that the gummy version is easy to chew and has a nice texture. For example, the Ultra Strength Women’s Multi + Omega-3 has an average rating of 4.6 out of 5 stars on Amazon, which is based on 33,155 reviews. In terms of customer satisfaction, many Olly products are highly rated. Olly was also involved in a 2021 lawsuit involving digital accessibility issues with its website. In 2022, Olly was named in a class-action lawsuit, which alleged that the company misled consumers by inaccurately dosing some supplements that contained melatonin. Additionally, Olly does not make any unacceptable or unsubstantiated health claims about its products.Īs of the time of publication, Olly is not accredited by the Better Business Bureau (BBB) and holds a C+ rating from the organization, which is based on factors such as the company’s complaint history and business practices. Olly is NSF certified, and all supplements are tested by a third-party lab. Olly has a solid reputation as a quality supplement manufacturer, and its products are available at a variety of retailers. Sleep Blackberry Zen is NSF certified, gluten-free, and formulated without any artificial flavors or colors. While studies have shown an effective dose ranging from 200 to 400 milligrams (mg), Sleep Blackberry Zen contains only 100 mg of L-theanine per serving.Īdditionally, as with other Olly supplements, Sleep Blackberry Zen’s effectiveness has not been studied. It may also improve sleep quality when combined with other ingredients, such as GABA or magnesium ( 24, 25, 26, 27). Some research also suggests that L-theanine may relieve stress, which could help support rest and relaxation. Studies show that melatonin may be quite beneficial for improving sleep quality, especially in people with sleep disorders such as insomnia ( 23). Made with melatonin, L-theanine, and botanicals, Olly’s Sleep Blackberry Zen is designed to promote relaxation and support a healthy sleep cycle. Active ingredients: L-theanine, melatonin, chamomile extract, passionflower extract, and lemon balm extract.Nutrition per 2-gummy serving ( 22): 15 calories, 3 g carbs, 2 g added sugars, This product is NSF certified and free of gluten and artificial ingredients. However, some people may have difficulty tolerating these ingredients and may experience digestive side effects ( 16). Olly Probiotic + Prebiotic also contains xylitol and inulin, both of which can promote digestive health by enhancing the growth of beneficial gut bacteria ( 13, 14, 15). However, keep in mind that most studies use significantly higher doses of B. This is a strain of bacteria that has been shown to reduce symptoms of irritable bowel syndrome (IBS) and other digestive disorders ( 10, 11, 12). Specifically, it contains 500 million colony-forming units (CFUs) of Bacillus coagulans MTCC 5856 per gummy. Olly’s peach-flavored Probiotic + Prebiotic supplement claims to help balance the digestive system and is made with a blend of live cultures and gut-friendly fiber. Active ingredients: Bacillus coagulans MTCC 5856, prebiotic blend (fructooligosaccharides, inulin, xylitol).Nutrition per 1-gummy serving ( 9): 5 calories, 2 g carbs, 1 g fiber, Like several other Olly products, Goodbye Stress is gluten-free, made without artificial ingredients, and NSF certified. Furthermore, there’s no research on the effectiveness of this supplement specifically. Overall, while L-theanine and lemon balm may help reduce stress levels, more research is necessary. In fact, a 2020 review on the effects of GABA concluded that there is limited evidence to support any beneficial effects on stress ( 8). Limited research also suggests that lemon balm may be helpful for reducing symptoms of depression and anxiety ( 7).īut more research on GABA’s effects is needed. L-theanine is a compound found in green tea that has been shown to reduce symptoms of stress and improve attention ( 5, 6). Active ingredients: GABA, L-theanine, lemon balm extractįeaturing gamma-aminobutyric acid (GABA), L-theanine, and lemon balm, this strawberry verbena-flavored supplement is formulated to promote calmness and alertness.Nutrition per 2-gummy serving ( 4): 15 calories, 3 g carbs, 2 g added sugars. ![]() ![]() ![]() The system features roof-mounted antennas. It automatically maintains pre-established blade position without the need for added hardware or a GPS signal.Ĭat Slope Indicate is also standard, and displays machine cross-slope and fore/aft orientation on the primary monitor, assisting operators to work accurately on slopes.Ĭat Stable Blade, another standard feature, complements the operator's blade-control input to achieve finish grades faster with less effort.Ĭat GRADE with 3D is an available, factory-integrated grade-control system that provides three-dimensional guidance both for production dozing and fine grading. To get the most out of this dozer, there are numerous machine-assist and machine-control systems that come standard or as an option.Ĭat Connect GRADE technologies range from simple grade indicators to full factory-integrated GPS, all supported by Caterpillar and Cat dealers.Ĭat GRADE with Slope Assist is a new standard feature for the D6T. Just set the desired ground speed and the Auto Shift system smoothly and automatically chooses the optimal gear and engine speed to match operating conditions. The four-speed transmission also delivers fuel savings: up to 20 percent in heavy work and as much as 30 percent in light work and finish grading applications. ![]() The operator also experiences an aggressive feel in the dirt. This allows the machine to remain in the most efficient mode for a higher percentage of the time and raises productivity by up to 2.5 percent. The extra gear between first and second provides smooth shifting and also maintains power to the ground during load changes. The D6T has a new, fully automatic, four-speed transmission. These include easier operation, higher performance, a wealth of standard and optional machine-assist and machine-control systems, and significant fuel savings. Caterpillar has taken dozer work to new levels with the D6T dozer. ![]() ![]() ![]() How to Deactivate Friend Requests for Live on Find My Toggle the location, making sure it’s grey. If you want to prevent everyone from seeing your location, open the “Me” window. Confirm your decision in the next dialog box.Tap “Stop Sharing Location” on the next screen.Choose the person you wish to hide your location from.If you wish to turn it off, you’ll need to terminate location sharing. In other words, sharing your location automatically starts the “Live” function. The “Live” feature is an integral part of the new iOS ecosystem, and there’s no way to activate your location sharing without enabling live location. Alternatively, you can delete all information or lock it to safeguard against data theft. You can now use several features to help retrieve it, like making the gadget play sounds, or send it messages. This should reveal the location of the device. Find the missing gadget and press the corresponding entry.Tap the “Devices” section to obtain a list of devices that belong to your Apply Family or Apple ID.Enabling this function requires no advanced technical know-how: Besides using the “Live” feature to locate your friends, it can also detect missing Apple devices, such as AirPods, Apple Watches, MacBooks, iPads, and iPhones. One of the most impressive features of the Find My app is its versatility. How to Track Down Missing Devices in Find My The prompt should appear on their screen, and you’ll see where they are if they accept it. Click the option, and the platform will notify the other user that you want to track their live whereabouts. Scroll and find the prompt that lets you ask people to follow their location.To send requests for live locations, select the individual who has access to your whereabouts in the “People” window.Therefore, you’ll need to send them a request. Open Find My and head to “People.” Here, you’ll see all the individuals who you’ve shared your whereabouts with, but their location won’t show if they haven’t shared it.Locating someone who’s shared their location is easy, but what about people who haven’t disclosed their whereabouts? You’ll need to do a little digging: On top of that, the platform can offer directions to them, disclose your whereabouts, and alert you when they move. You can also open their location to reveal their full address and options to contact them. Tapping their name should provide additional details, such as their speed and potential destination. The map in the upper section should indicate their location.Navigate to the “People” section and look for the person you want to pinpoint.Here’s how to see someone who’s already shared their location with you: It should also read that the individual has access to your location.įind My is pretty straightforward, so you shouldn’t have problems detecting other people. While you’re sharing your whereabouts with someone, their name should show up in the “People” window. Tap the preferred option, and the app should start sharing your location immediately. Choose how long you want your whereabouts to be visible.After you’re finished adding your family and friends, hit “Send” in the upper-right section of the display. Repeat the process for as many individuals as necessary. Wait for the contact to appear and select it. Enter the name or number of the person who will have access to your location using the “To” window.Restart the application and tap the “+” symbol adjacent to the “People” section.To ensure the platform uses your iPhone as the location-sharing device, scroll down and choose the corresponding option. Hit the button near the “Share My Location” prompt.Open Find My and press the “Me” button in the lower part of the screen.Pick “While Using This App.” You should also consider enabling “Precise Location” in the same menu so that other users can keep track of you. Expand the menu that determines when the platform has location access.Start from “Settings” and select “Privacy,” followed by “Location Services.” ![]() ![]() After activating the app, you now need to grant it access to GPS.To do so, go to your “Settings” and tap “Your Name.” After enabling location services, you’ll need to activate Find My with your ID.Head to “Location Services” and press the button next to the “Location Services” box so that it turns green.Access “Settings” and choose “Privacy.”.Activating this feature shouldn’t give you a hard time. This way, connected individuals can react on time if something goes wrong. Gaining insight into other people’s whereabouts is useful, but you should also reveal your location. ![]() ![]() Stats: 35 points, 12 rebounds, 11 assists, 5 steals, 1 block Butler was everywhere on the floor, from facilitating to scoring, to defending Lakers superstar LeBron James. ![]() Butler exceeded as he would go on to drop a 40-point triple-double, and prevented the Lakers from going up three games to nothing. Bam Adebayo and Goran Dragić had both gotten injured in the first game of the series, which had a big affect on the Heat as they were both key starters on this underdog Miami team, so it was now up to Butler to lead the Heat to a win. ![]() The Miami Heat started off their first finals appearance in six years, losing the first two games of the series to the Lakers. Stats: 40 points, 11 rebounds, 13 assists, 2 steals, 2 blocks Butler at the time was dealing with knee inflammation, and Wade gave him motivation to play through it and continue to build his legacy. ![]() Although Butler credits his teammates for his performance, he also credits a phone-call and text from Miami Heat legend Dwyane Wade. Butler helped the Heat go on to face the Celtics in a game seven. Tucker told Butler before the game that the Heat needed 50-points from him, Butler didn’t respond, only giving Tucker a nod, and proceeded to go deliver. This game is Butler’s biggest game of his career in front of live Heat fans, the Miami Heat were facing elimination, and were in a must-win situation. Stats: 47 points, 9 rebounds, 8 assists, 4 steals (For more on the Miami Heat, check out the Five on the Floor podcast) Miami would go on to win this series, winning four games to Atlanta’s one. This was Butler’s first big game in the 2021-22 playoffs, with more great peformances to follow. Butler responded huge, resulting in his fourth career highest points in a game. Jimmy Butler’s big game against the Hawks, can be seen as an answer back to Trae Young, after Butler and Young got into a face-to-face altercation in the previous game, which was the first game of the Hawks-Heat playoff matchup. Stats: 45 points, 5 rebounds, 5 assists, 2 steals
![]() ![]() If, for example, P(A) 0.65 represents the probability that Bob does not do his homework, his teacher Sally can predict the probability that Bob does his homework. It is represented by the formula an a1 + (n-1)d, where a1 is the first term of the sequence, an is the nth term of the sequence, and d is the common difference, which is obtained by. There are also cases where there are mutations non-stop codon so transcription cannot stop. Complement of A and B Given a probability A, denoted by P(A), it is simple to calculate the complement, or the probability that the event described by P(A) does not occur, P(A'). What is an arithmetic Sequence An arithmetic sequence is a sequence of numbers in which each term is obtained by adding a fixed number to the previous term. Mediated by nucleotides at position +4 and position Highly influential effects on termination readthrough It is possible to perform several manipulations simultaneously. Stop codons (UAA>UAG>UGA) was observed, with This tool is useful for manipulating nucleic acid sequences (reverse, reverse/complement, and double stranded). Each nucleotide is described by a letter (among A, C, G, T, U) and the codon can therefore be described by these 3 letters, but also by the name of the amino acid. You have an opportunity to learn what the two's complement representation is and how to work with negative numbers in binary systems. The expected hierarchy in the intrinsic fidelity of the What is a codon (Definition) A codon is a sequence of 3 molecules/nucleotides describing an amino acid in the sequencing of DNA or messenger RNA (mRNA) or transfert (tRNA). Here is the two's complement calculator (or 2's complement calculator), a fantastic tool that helps you find the opposite of any binary number and turn this two's complement to a decimal value. In C++ it's better to return a value from a function than to manipulate a variable via pointer.Usually nucleotides present in mRNA channel downstream the A site help determining the future.Std::cout << "Reverse Compliment: " << std::endl << seq << std::endl For complementary sequences in biology, see complementarity (molecular biology). Std::cout << "DNA sequence: " << std::endl << seq << std::endl Std::string seq("TGAGACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTG") Ambiguity codes of the three possible nucleotides are converted as following: BV, DH. IUPAC ambiguity codes of the two possible nucleotides are converted as following: RY, KM, S and W unchanged. Std::transform(seq.cbegin(), seq.cend(), seq.begin(), lambda) Both DNA and RNA sequence is converted into reverse-complementing sequence of DNA. Throw std::domain_error("Invalid nucleotide.") The following code is C++11 (do you have C++11 compiler?) written as I would do it. ![]() If you don't like pointers, please, don't use them! In modern C++ pointers aren't often necessary. I've been programming in Java for over a year now so I've gotten really rusty with pointers in C++, I'm guessing the problem lies in the reverse methods and the way to pointers are shifted around through each pass of the function call #includeĬhar s = Ĭout << "DNA sequence: "<< endl << s << endl Ĭout << "Reverse Compliment: "<< endl << s << endl Ĭhange the reverse method like this void reverse(char s) It attempts to calculate the best match for the selected sequences. The complements for each letter in the sequence are ClustalW2 is a general purpose multiple sequence alignment program for DNA or proteins. However my output didn't work as expected. ![]() So I am trying to create the complement of the sequence ![]() ![]() ![]() That'll give you some extra traction when the tread block is gripping around rocks or whichever obstacle it is that you're trying to get over. It's a full-depth sipe, which means that it'll go down to the base of the tread, which is nice because it helps the tread block flex and fold a little bit when you're at lower tire pressures while off-roading. It's got some siping on it through the tread blocks, and there is even some siping in the center tread blocks. Part of the X3's high off-road performance capabilities come from the design of the tire itself. But if you're looking for great off-road traction, the X3 is really the way to go. We've heard that the X3 is pretty decent in the winter as well, though for the best performance there, the General Grabber All-Terrain is still your best option. Synonymous with mud tires is that they do run a little bit more of a softer compound, which will give you additional traction while off-roading, but if you're running your X3s on the road, expect them to wear out a bit faster than hybrid or all-terrain tires. Is The General Grabber X3 Good For Off-Roading and Overlanding? Of course, it's a general rule of thumb that a more aggressive tire will have more road noise- it's just what happens because there are more tread voids in between those tread logs, and more space to allow the tread to come around and hit the pavement. You can hear them, but it's not terrible. With that said, the Grabber X3s aren't horrendously loud - they're not slapping the pavement or making a super loud howling sound or anything like that. If you want a quiet ride, especially on the highway, then you'll want to look at more of a hybrid terrain tire, or even an all-terrain tire if you're willing to give up some off-road capabilities. Read More: What Is The Difference Between All-Terrain and Hybrid Tires?ĭoes The General Grabber X3 Make A Lot Of Road Noise?Īfter running the Grabber X3 for a couple thousand miles, we can report that they are a bit noisy, but that's to be expected out of a mud tire. The X3 was actually built for the off-road racing industry, and began as what General referred to as a "red-letter" tire - the same technology that was used in Baja and short course off-road racing has been built right into the General Grabber X3, so you're getting that strong, reliable, durable construction out of a DOT-compliant, race-influenced tire. This also means that the General Grabber X3 is extremely resistant to sidewalk cuts and punctures, thanks to the different woven fibers that create it. But if you're aired down on the trail, you're putting a lot of pressure and stress on the tires, but they're still not going to come apart on you. The way the tire is manufactured and engineered gives it a super strong carcass, and that means that if you have a flat tire, for example, it'll still hold up, at least for a little while. Duragen is a blend of woven fibers which is three-ply thick in the sidewalls, and in the construction of the carcass of the tire. One of the biggest things that General talks about is the construction of its tire, known as Duragen Technology. So let's jump into it and see what the Grabber X3 can do.Ĭonstruction And Durability Of The General Grabber X3 Mud-Terrain The General Grabber X3 is a perfect, worthy option for everything from overlanding vehicles to work trucks, construction vehicles, and anything that will be heading off the road and needs a maximum traction tire to help them out, while also having decent on-road manners. And you do see a lot of them out there, so today we'll be breaking down how we like them, some of their best features, and how well they can handle themselves in the roughest off-road situations. One of the tires that we haven't had much time to talk about here at TrailBuilt is the General Grabber X3 Mud Terrain, and we're pretty excited about it - after all, it's synonymous with overlanders. Is The General Grabber X3 A Good Off-Road Tire? General Grabber X3 Mud-Terrain Tire Review August 3, 2022 ![]() ![]() and many more - make things come alive and simple! Screen Recorder - DU Recorder allows for easy video recording such as video games, video calls, live performances, music videos. ![]() With various features like video recording and editing, screen captures do not need ROOT. If you have any suggestions or questions, don't hesitate to contact support Thank you so much! Your contributions will help us continue to develop the app better in the future versions.► Download the most easy to use Screen Recorder - Face Cam & Screenshot Capture now and create your first, amazing video!ĭu Screen Recorder - Face Cam, Screenshot Capture and Video Editor is a free, stable and easy-to-use screen recorder application, the highest quality video for Android devices, allowing you to record video on the phone screen while playing games smoothly and clearly. We are working our best on making the application better and more useful for you. ✨ Try it out today and see for yourself the magic of Screen Recorder, AI Recorder! ✨ Screen Recorder is the perfect solution for anyone looking to create engaging, professional content. Screen Recorder screen recording app for android makes it easy to create high-quality content, no matter what your experience level is. With our app, users no longer have to worry about the quality of their recordings, or struggle to find the right tools to edit and enhance their content. Plus, with our high-quality recording and editing tools, their content will look more professional than ever before. Instead of using multiple apps to record, edit, and share your content, you can do it all in one place with Screen Recorder quick video recorder app. Our app offers many features for you to record and edit your video. Image editing tool give you a quick solution to stitch, blur and crop your screenshot while recording Share your content with your followers in real-timeĬapture and enhance screenshots with ease. Livestream your screen to your favorite platforms like Youtube, Facebook, Twitch, etc Record your screen with no time limit, no time limit recorder screen videoĮdit your videos with ease using our intuitive editing interfaceĬut, merge and add music to your footage videos to create the perfect final productĮdit video without lowering the quality of videos Record your videos in high-quality: up to 1080p and 60 FPS, free screen recorder with audio Record gameplay with screen recorder free on your phone to share with friends □Key feature of Screen Recorder, AI Recorder□Ĭapture video of your screen with one tap, include audio in your video recorder, suitable game recorder app for free fire, game recorder app for pubg Share your content to many platforms: Youtube, Facebook, Twitch, Bigo Live, … What Screen Recorder game play video recorder app will give youĪbility to capture your screen and take screenshot in a blink of an eye with screen recorder gameplayĮasy to use! You don't have to be a tech expert to use it because everything is laid out intuitively, making it easy for you to find and use the features you need.Ĭompletely free to use, no watermark included Whether you just need a screen recording app with audio to record your screen or you want to capture your best moments while playing games, Screen Recorder is just for you. You can even livestream your screen to multiple platforms! Plus, with our built-in video editor, you can trim, cut, and add effects to your footage to create the perfect final product. ![]() Our video recorder game app records at the best possible quality, ensuring that your videos look crisp and clear every time. With Screen Recorder gameplay recorder app with sound, you can easily capture high-quality video of your screen and record screen video with sound with just a few taps. If you need to create tutorials, share your gameplay, or capture important moments on your device, Screen Recorder screen video recorder app has everything you need to get the job done. Introducing Screen Recorder, the ultimate all-in-one app for recording, editing, and live streaming your screen! Screen video recorder with sound to record screen video & take screenshot HD! ![]() ![]() ![]() ![]() It's a good idea to use a bladder training chart to record each time you pass urine and the volume of urine passed. You'll then gradually increase how long you wait. You'll be given a target, such as waiting 5 to 15 minutes when you feel the urge to pee. Bladder trainingīladder training is an exercise programme that aims to help you last longer without peeing and hold more pee in your bladder. The tube connects to a bag that you can strap to your leg under your clothing. They look like condoms with a tube coming out of the end. Urinary sheaths can also help with dribbling. Using pads or a sheathĪbsorbent pads and pants can be worn inside your underwear, or may replace your underwear altogether. Eating more fibreĮating more fibre (which is found in fruit, vegetables and wholegrain cereals) can help you avoid constipation, which can put pressure on your bladder and make the symptoms of an enlarged prostate worse. Checking your medicinesĬheck with your doctor whether any medicines you take, such as antidepressants or decongestants, might be making your urinary symptoms worse. It can help you empty your bladder properly. Double voidingĭouble voiding involves waiting a few moments after you have finished peeing before trying to go again. Remember to go to the toilet before long journeys or when you know you will not be able to reach a toilet easily. ![]() Make sure you're still drinking enough fluid earlier in the day. This might help you avoid getting up in the night. Try to reduce the amount of fluids you drink in the evening and avoid drinking anything for 2 hours before you go to bed. Drink fewer fizzy drinks and less alcohol, caffeine and artificial sweetenersįizzy drinks and drinks that contain alcohol, caffeine (such as tea, coffee or cola) and artificial sweeteners can irritate the bladder and make urinary symptoms worse. You might be able to relieve the symptoms by making some simple changes to your lifestyle. The treatment for an enlarged prostate gland will depend on how badly the symptoms are affecting your qualify of life. ![]() ![]() ![]() Property Tax: this is the local rate home owners are charged to pay for various municipal expenses. Extra payments applied directly to the principal early in the loan term can save many years off the life of the loan. If a home buyer opts for a 30-year loan, most of their early payments will go toward interest on the loan. The 30-year fixed-rate loan is the most common term in the United States, but as the economy has went through more frequent booms & busts this century it can make sense to purchase a smaller home with a 15-year mortgage. Loan Term: the number of years the loan is scheduled to be paid over. For your convenience we also publish current local mortgage rates. This calculator can help home buyers figure out if it makes sense to buy points to lower their rate of interest. If the buyer believes interest rates will fall or plans on moving in a few years then points are a less compelling option. In general discount points are a better value if the borrower intends to live in the home for an extended period of time & they expect interest rates to rise. In some cases a borrower may want to pay points to lower the effective interest rate. Interest Rate: this is the quoted APR a bank charges the borrower. If the loan amount is above 80% of the appraisal then PMI is required until the loan is paid off enough to where the Loan-to-value (LTV) is below 80%. Loan Amount: the amount a borrower is borrowing against the home. This is used in part to determine if property mortgage insurance (PMI) is needed. Home Value: the appraised value of a home. ![]() |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |